A

Cleavage site

2—YYYYAATACGNNNNN—

CRRRRAC CNNNNN,,

Triplex formation

Fig. 10.12 Two deoxyribozymes that cleave a DNA strand. (a) The secondary structure of the Cu(II)-dependent class II DNA-cleaving de-oxyribozyme. Y, R, and N represent a pyrimi-dine, purine, and any nucleotide, respectively The major cleavage site is shown with an arrow. Covariation experiments have shown the existence of two stems in the active structure. Similar experiments involving one of the stems and a polypyrimidine tract have revealed that the DNAzyme structure contains a triplex

__Cleavage site pCGTAGCGG TAAGCTTGGCAC £ I • I I III CACGTC— CCACGGCT

-AACGGCTTGG

T TGACGGGCTC-

AATG CTTATT-1

GCCGCTGTTGTTCTCTATAG • I I I I I I I II I 111111» TGGCGACTACAA*AGATATT—'

helical region (triplex interactions represented by *). (b) Proposed secondary structure model for the 10-28 N-glycosylase DNAzyme. The model was made from analysis of sequences obtained from a reselection of 10-28 in which there was a 10% mutation rate per nucleotide. The site of depurination is shown as a hollow letter. The * shows the point where the DNA-zyme and substrate portions can be separated to form a trans construct.

Deoxyribozymes have also been isolated that catalyze the cleavage of DNA through an alternative mechanism: N-glycosylation of a guanine base followed by p-elimination (Sheppard et al., 2000). In this case, the lack of a 2'-hydroxyl, which makes the phosphodiester bonds of DNA less susceptible to hydrolysis compared with RNA, actually helps to make the N-glycosyl bonds within DNA more susceptible to hydrolysis. After hydrolysis of the N-glycosyl bond, the 3'-phosphate group becomes more susceptible to p-elimination. DNAzymes with this N-glycosylase activity were first discovered during an in vitro selection designed to isolate DNAzymes that cleave p-1,4-O-glycosidic bonds between the galactose and glucose subunits of lactose (Sheppard et al., 2000). It was found that the cleavage products did not correspond to cleavage at the glycosidic bond within lactose, but rather to cleavage at the deoxyguanine residue downstream of the lactose. The fact that cleavage activity was not inhibited by DTT indicated that the cleavage reaction was not proceeding by an oxidative mechanism. Addition of spermidine or piperidine enhanced the cleavage rate. Since these chemical agents excise deoxyribose from apurinated sites, the enhanced reaction rate supports a cleavage mechanism that operates via N-glycosylation and p-elimination. A further selection was carried out to select for N-glycolyase DNAzymes with enhanced catalytic activity. One deoxyribozyme, named "10-28," has the proposed secondary structure shown in Fig. 10.12b. The model contains two hairpin structures, near the 5' and 3' ends. Between these hairpins are two stems of 9 and 18 base pairs. Support for these stems comes from sequence analyses, which show some base covariations in certain sequences seen in the selected population.

DNA-modifying DNA Enzymes

In addition to their ability for self-cleavage, DNAzymes have been isolated for other self-modification reactions. Several of these DNAzymes catalyze reactions that mimic DNA modifications traditionally carried out by protein enzymes. One example is the 5' phosphorylation of DNA molecules by polynucleotide kinases (PNKs). Two separate in vitro selection experiments have yielded many self-phosphorylating DNAzymes that catalyze the transfer of a g-phosphate from a ribonucleotide triphosphate (NTP) or deoxyribonucleotide triphosphate (dNTP) to their own 5' end (Li and Breaker, 1999; Wang et al., 2002) (Fig. 10.13a). The first selection was designed to isolate self-phosphorylating DNAzymes that could utilize different NTPs/dNTPs as a phosphate source, and show discrimination between these molecules (Li and Breaker, 1999). Using a series of parallel selections which incorporated different (d)NTPs, numerous catalysts were ultimately isolated with wide ranging properties. When supplied with all four standard NTPs or dNTPs, selection from a random DNA library produced many unique catalytic sequences. Two major functional classes were identified in both the NTP and dNTP selection. One class was dependent on (d)GTP as a substrate while the other class could use any of the four (d)NTPs as a source of phosphate. When selection was continued with only a spe-

Fig. 10.13 DNAzymes for DNA phosphorylation. (a) DNA phosphorylation reaction. The 5'-OH performs a nucleophilic attack on the g phosphorous of an ATP molecule. This results in phosphate transfer and the formation of 5'-phosphorylated DNA and an ADP molecule. (b) The secondary structure of NTP-A1. The four GGG elements are proposed to form a guanine quartet structure. Boxed regions were shown to be highly conserved in reselection experiments. The 3' region of the NTP-A1 shown with a dashed line can be truncated without significant loss of activity. A bimole-cular DNAzyme system shows activity with the site of separation shown by the * in the figure.

Fig. 10.13 DNAzymes for DNA phosphorylation. (a) DNA phosphorylation reaction. The 5'-OH performs a nucleophilic attack on the g phosphorous of an ATP molecule. This results in phosphate transfer and the formation of 5'-phosphorylated DNA and an ADP molecule. (b) The secondary structure of NTP-A1. The four GGG elements are proposed to form a guanine quartet structure. Boxed regions were shown to be highly conserved in reselection experiments. The 3' region of the NTP-A1 shown with a dashed line can be truncated without significant loss of activity. A bimole-cular DNAzyme system shows activity with the site of separation shown by the * in the figure.

cific (d)NTP, DNAzymes were eventually isolated that were specific for each of the remaining (d)NTPs, except dTTP. The fact that these DNAzymes could selectively use one (d)NTP as a substrate over another, demonstrates that DNA is capable of discriminating between chemically similar molecules. This selectivity is further exemplified by the isolation of a pair of DNAzymes that can discriminate between GTP and dGTP, which differ only in the presence of a 2'-hydroxyl group in the former.

A reselection was conducted on a representative ATP-utilizing DNAzyme named NTP-A1. This led to the isolation of an improved catalyst exhibiting a kcat of -0.01 min-1, corresponding to a rate enhancement of 109-fold. The proposed secondary structure for NTP-A1 is shown in Fig. 10.13b. This DNAzyme is one of many catalytic DNAs whose structure appears to have a guanine quartet-containing structure (see more discussion below).

In another experiment by Wang and co-workers, self-phosphorylating DNAzymes with different divalent metal ion requirements were isolated by conducting a series of parallel selections each utilizing a different divalent metal cofactor (Wang et al., 2002). When Mn2+ (or Cu2+) was used as the sole divalent cofactor, they discovered many unique catalysts that were Mn2+ (or Cu2+)-depen-dent but could not utilize other divalent metal ions as cofactors. On the other hand, in selections where Ca2+ or Mg2+ were used, only a few unique catalytic sequences emerged, and these catalysts could function using any one of four different divalent metal ions (Ca2+, Cu2+, Mg2+, Mn2+). These results suggest that DNA-zymes with specific or broad cofactor requirements can be isolated, and that the level of divalent cofactor specificity is likely dependent on the type of metal ions initially supplied in the selection. The same study resulted in two Mn2+-depen-dent self-phosphorylating deoxyribozymes, named Dk1 and Dk2, that displayed a kcat of 2.8 and 0.8 min-1, respectively.

Self-capping (or self-adenylating) DNAzymes represent another functional class of self-modifying DNA, which mimic the first reaction catalyzed by T4 DNA ligase. In this reaction, T4 DNA ligase catalyzes the addition of AMP to the 5'-phosphorylated end of a DNA molecule to form an AppDNA. The reaction proceeds via nucleophilic attack of a phosphate oxygen against the a-phosphorus atom of an ATP molecule, resulting in a DNA molecule with an adenylyl 5'-5'-pyrophosphate cap (Fig. 10.14a). Selection for these DNAzymes was carried out using a combinatorial library of 5'-phosphorylated DNA molecules (Y. Li et al., 2000b). After incubation for the desired capping activity, the pool was supplied with T4 DNA ligase as well as a template and acceptor DNA strand. In the absence of ATP, only molecules possessing an App cap could be ligated to the acceptor DNA molecule by T4 DNA ligase and subsequently separated by gel electrophoresis. Ultimately, 12 distinct classes of self-capping DNAzymes were isolated and the dominant class denoted as "class-I capase deoxyribozyme." The self-capping ability of the class I capase deoxyribozyme, which boasted a rate enhancement of 1010-fold, was confirmed by the observation that periodate oxidation/p-elimination treatment was necessary for dephosphorylation of the reacted DNAzymes. Additional evidence was provided by experiments using different radiolabeled ATPs, indicating the DNAzymes were indeed catalyzing the transfer

Fig. 10.14 DNAzymes for DNA capping.

(a) 5'-Self-capping reaction scheme. The reaction proceeds via nucleophilic attack of an oxygen from a 5'-phosphorylated DNA on the a-phosphate of an ATP molecule. This results in a DNA strand with a 5' pyrophosphate "cap."

(b) A secondary structure model for the class I

Fig. 10.14 DNAzymes for DNA capping.

(a) 5'-Self-capping reaction scheme. The reaction proceeds via nucleophilic attack of an oxygen from a 5'-phosphorylated DNA on the a-phosphate of an ATP molecule. This results in a DNA strand with a 5' pyrophosphate "cap."

(b) A secondary structure model for the class I

capase deoxyribozyme. It contains a four-tier guanine quartet (three complete and one incomplete) predicted from guanine N7 methy-lation interference assays. The p indicates the phosphate group at the 5' end of the DNA-zyme.

Fig. 10.15 DNA enzymes for DNA ligation. (a) DNAzyme-catalyzed DNA ligation reaction scheme. The 3l-hydroxyl at the terminus of a DNA strand performs nucleophilic attack on a phosphate in the pyrophosphate cap of a 5'-

capped DNA strand. This results in formation of a phosphodiester bond between the two strands. (b) A secondary structure model for a trimolecular DNA ligating DNAzyme.

Fig. 10.15 DNA enzymes for DNA ligation. (a) DNAzyme-catalyzed DNA ligation reaction scheme. The 3l-hydroxyl at the terminus of a DNA strand performs nucleophilic attack on a phosphate in the pyrophosphate cap of a 5'-

capped DNA strand. This results in formation of a phosphodiester bond between the two strands. (b) A secondary structure model for a trimolecular DNA ligating DNAzyme.

of AMP to the 5' end of the phosphorylated DNAzyme. The class I capase has the proposed guanine quartet-based secondary structure shown in Fig. 10.14b.

DNAzymes have also been isolated that mimic the second reaction catalyzed by T4 DNA ligase (Sreedhara et al., 2004). In this reaction, a DNA molecule with an App moiety (AppDNA) is joined to an acceptor DNA molecule to form a 3'-5' phosphodiester linkage (Fig. 10.15a). This new selection effort utilized the previously mentioned class I capase deoxyribozyme as the source of AppDNA, which was then incubated with a randomized DNA library. The selection yielded DNAzymes capable of forming a 3'-5' linkage between the two DNA molecules, as reflected by the fact that PCR amplification can only proceed in the presence of 3'-5'-linked DNA. Thus, only DNAzymes that could catalyze this reaction would be amplified during each round of in vitro selection. The isolated DNAzyme was configured into a trimolecular DNA ligating system (Fig. 10.15b). The three internal stems and the helical interactions between the DNAzyme and 3'-substrate (AppDNA) are supported by covariation and mismatch experiments.

DNA Enzymes that Catalyze the Formation of Phosphorothioester Bond

In addition to the formation of 3'-5' phosphodiester linkages, DNAzymes have been isolated that catalyze the formation of a non-natural bond between DNA molecules (Levy and Ellington, 2001, 2002). It was known that two DNA fragments, one with a 3l-phosphothioate and the other with a 5l-iodine, became ligated in the presence of a "splint" DNA fragment to form a 5'-phosphothioester linkage (Xu and Kool, 1999) (Fig. 10.16). Since the uncatalyzed reaction is relatively slow, in vitro selection was conducted to identify DNAzymes that could increase the rate of this transformation. Although DNA molecules that catalyzed the reaction were eventually obtained, the rate could not be improved beyond about two per hour despite multiple rounds of selection (Levy and Ellington, 2001). Using the

10.3 Other Deoxyribozymes | 253

Fig. 10.16 DNA enzymes catalyzing the formation of phosphorothioester bond. In this reaction a DNAzyme with a 5'-iodo group is reacted with a DNA molecule with a terminal 3' phosphothioate. This results in nucleophilic displacement of the iodine with the generation of a DNA ligation product containing one bridging sulfur atom instead of an oxygen at the ligation junction.

same general system, a second selection was carried out to isolate DNAzymes that could form phosphothioester linkages with different substrates (Levy and Ellington, 2002). This was achieved by alternating between one of five different substrates during each round of selection, where each substrate shared six nucleo-tides in common adjacent to the 3'-phosphothioate. DNAzymes were isolated that could catalyze the ligation of all five different substrates, suggesting that DNAzymes could have secondary structures capable of accommodating different base sequences, and that future DNAzymes might be developed that could act as universal DNA ligases or replicases.

Deoxyribozymes for Thymine Dimer Repair

Exposure to UV light produces damaging lesions in DNA, of which the thymine dimer is the most predominant. Many different strategies have been developed over the course of evolution to repair these damaging lesions. One such solution is the existence of photolyase enzymes that use lower energy light (compared with the light that produces thymine dimers) to excite chromophores, which donate electrons to the thymine dimer leading to its destabilization and reversion to thy-mine monomers. An in vitro selection was conducted to isolate DNAzymes that mimic this photoreaction (Chinnapen and Sen, 2004) (Fig. 10.17a). Serotonin was used as a cofactor because the indole group is an adequate sensitizer in the tryptophan residues of protein-catalyzed photoreactions. The thymine dimer was produced between two DNA fragments containing a 5'-thymine and a 3'-thy-mine, along with a splint DNA that was complimentary to the dimerization site and the flanking 5' and 3' regions of the DNA molecules. UV light of wavelength 337 nm was the stimulus for dimerization. The dimerized constructs were then used as PCR primers to amplify the random-sequence DNA library, allowing their incorporation into the DNA pool. DNA molecules that catalyze self-repair at their thymine dimer site could be isolated by virtue of the fact that dimer synthesis produced molecules lacking a phosphodiester linkage at their dimerization

Fig. 10.17 DNAzymes for thymine dimer repair.

(a) Thymine dimer repair reaction scheme. Absorption of light energy results in electron transfer to the thymine dimer initiating the cycloinversion repair process, which transforms the dimer into two adjacent thymine residues.

(b) Proposed secondary structure for UV1C, a thymine dimer repair DNAzyme.

site. Therefore, after repair the remaining dimerized fragments could be separated from the repaired DNAs based on size. Serotonin-dependent and serotonin-independent selections were performed, which led to the isolation of one dominant sequence class in the serotonin-independent selection and two major sequence classes in the serotonin-dependent selection.

The fact that a serotonin-independent selection (originally a negative selection) yielded DNA catalysts was quite surprising, since neither thymine dimers nor DNA absorb at the longer wavelengths (>300 nm) used in that selection. A bimo-lecular experiment performed with the dominant sequence, UV1C, from the serotonin-independent selection, showed that the repair DNAzyme could successfully work in "trans" (in which the dimer fragment was physically separated from the enzyme domain). To determine whether the DNAzyme was acting solely to position the dimer in a photoreactive orientation, tests were done with dimer-containing DNA molecules and splint DNA. These tests did not show activity above the background reaction, indicating that the DNAzyme was performing the intended catalytic repair reaction. The proposed secondary structure for UV1C is shown in Fig. 10.17b. Only a few Watson-Crick interactions (shown with lines) have been identified in the structure, indicating that extensive tertiary interactions are used by this deoxyribozyme. Several guanine bases are proposed to be involved in the formation of guanine quartets (shown as hollow letters in Fig. 10.17b). Evidence for the existence of guanine quartets includes the requirement of the DNAzyme for potassium, and methylation protection of the N7 position of the concerned guanines. In addition, this DNAzyme has spectral properties that are consistent with the presence of guanine quartets.

DNA Enzymes with Foreign Functionalities

One of the major criticisms of DNA in terms of its potential as a catalyst is the fact that it is limited in the number of different interactions it can form, since it is composed of only four chemically similar building blocks. Although numer

Fig. 10.17 DNAzymes for thymine dimer repair.

(a) Thymine dimer repair reaction scheme. Absorption of light energy results in electron transfer to the thymine dimer initiating the cycloinversion repair process, which transforms the dimer into two adjacent thymine residues.

(b) Proposed secondary structure for UV1C, a thymine dimer repair DNAzyme.

ous DNAzymes have been isolated that can perform efficient catalysis despite this limitation, the addition of extra chemical moieties to a strand of DNA could increase the number of interactions DNA can form with itself, ligands, or substrate molecules. To date, three in vitro selection studies have been conducted to derive RNA-cleaving DNAzymes utilizing different base modifications. In the first study, a random-sequence library of DNA molecules containing C5 -imidazole deoxyur-idine residues were used for in vitro selection (Santoro et al., 2000). One isolated catalyst, denoted 16.2-11, was subsequently minimized to a 12-nt catalytic core, containing three critical imidazole deoxyuridine residues (Fig. 10.18a). The fact

Fig. 10.18 RNA-cleaving DNAzymes with foreign functionanities. (a) The secondary structure model for 16.2-11, a DNAzyme containing C5-imidazole deoxyuridine residues. The modified deoxyuridines critical for catalysis are shown with hollow U's and their chemical structure is shown on the right side of the figure. (b) Proposed secondary structure of 925-1 1, a DNAzyme capable of cleavage of an

Fig. 10.18 RNA-cleaving DNAzymes with foreign functionanities. (a) The secondary structure model for 16.2-11, a DNAzyme containing C5-imidazole deoxyuridine residues. The modified deoxyuridines critical for catalysis are shown with hollow U's and their chemical structure is shown on the right side of the figure. (b) Proposed secondary structure of 925-1 1, a DNAzyme capable of cleavage of an embedded RNA linkage in a strand of DNA. The modified bases 5-aminoallyl-dU and 8-histaminyl-dA are shown with italic U's and A's respectively, and are critical for activity of this modified DNAzyme. (c) An RNA-cleaving DNAzyme with C5-imidole deoxyuridine (hollow U) and 3-(aminopropynyl)-7-deaza-deoxyadenosine (hollow A). Cleavage sites are indicated by arrows.

that removal of these three residues resulted in loss of activity indicated that these modified bases were critical for folding or catalysis. Another group has isolated a modified RNA-cleaving deoxyribozyme, termed 925-11 (Fig. 10.18b), which contains two foreign functionalities: an imidazole group placed on deoxyadenosine (italicized "A" in the structure of 925-11) and an alkylamine attached to deoxyur-idine (italicized "U" in the same structure) (Perrin et al., 2001; Lermer et al., 2002). A third selection simultaneously used C5-imidazole deoxyuridine and 3-(aminopropynyl-)-7deaza-deoxyadenosine-modified DNA (Sidorov et al., 2004) (Fig. 10.18c). These modifications mimic the metal-independent reaction catalyzed by RNase A, which contains a catalytic histidine and lysine residue. The fact that these two modified bases represent histidine and lysine analogs, respectively, and the fact that the reaction rate decreases by two orders of magnitude when unmodified bases are used, indicate that the modified bases are likely playing an active role in catalysis. These examples illustrate how modified bases can be used advantageously to create DNAzymes, which may fold differently or catalyze reactions through different mechanisms not possible with native DNA.

10.4 Outlook

A decade ago, even after the discovery of catalytic RNA, an enzyme made from DNA would have been regarded as a fanciful notion with little merit. Rather than abandon the idea, however, a few researchers decided to abandon DNA's complementary strand. What they found was a single-stranded polymer with a remarkable aptitude for catalysis. Since then, the field of DNA enzymes has come a long way in a surprisingly short period of time. In just the first 10 years alone, hundreds of DNA enzymes have been created in vitro, catalyzing more than a dozen different chemical transformations, and boasting rate enhancements as large as 10 billion fold. The next 10 years promise to be just as exciting as researchers continue to challenge DNA with new functional problems, and aspire for rate enhancements that rival protein enzymes.

To date, nearly all DNA enzymes catalyze chemical reactions involved in the processing or modification of nucleic acids. Future in vitro selection efforts will no doubt aim to expand the existing collection to include reactions of both greater difficulty and diversity, such as the hydrolytic cleavage of DNA, peptide synthesis, and carbon-carbon bond formation. These reactions have so far eluded catalysis by DNA, but are not necessarily beyond its reach. A marriage between synthetic organic chemists and in vitro selection specialists would likely facilitate their creation, since specially modified substrates have to be attached to combinatorial DNA pools in order to apply "direct selection" techniques. Improvements in the selection methodology would also be highly beneficial toward this end.

Although in vitro selection has been used successfully many times in the past, this does not guarantee future success. During the formative years of DNAzyme research, the majority of time was naturally spent in the pursuit of new catalytic

DNA molecules. By comparison, little time was ever taken to understand the route by which they were created, and consequently, the underlying processes that govern the outcome of in vitro selection remain poorly characterized. The recurrence of 8-17 serves as a subtle indication that the existing in vitro selection approach, rather than DNA itself, may be a limiting factor in the isolation of new, more efficient, and functionally diverse DNAzymes. For instance, the catalytic rate of 8-17 coincides closely with the minimum reaction time that can be practically applied through manual quenching methods. Unless greater selection stringency can be imposed, the truly fast but exceedingly rare DNAzymes will have no selective advantage over motifs like 8-17, which are distributed more densely through sequence space. The isolation of exceptionally fast DNAzymes, therefore, will depend on our ability to raise the "speed limit" associated with manual quenching. Better ways of exploring sequence space must also be developed (as an added measure of security against future 8-17 recurrence). The reality of this problem is more apparent when you consider it would take around 30 000 tons of DNA to screen all the possible sequence permutations of a 50-nt combinatorial DNA library. Given the sheer magnitude of sequence space, the 8-17 motif likely represents only a local optimum, albeit one that occurs frequently along the catalytic fitness landscape. However, even with the current in vitro evolution protocols, we can only "walk" to neighboring regions of sequence space. To expedite our search for that elusive global optimum, we may need to implement ideas like non-homologous random recombination (Bittker et al., 2002, 2004), which will allow us to "jump" to non-contiguous stretches of sequence space. Recognizing the limitations of in vitro selection will no doubt be the first step toward correcting them.

The utility of DNAzyme has become more and more evident over the years, as the focus of research has largely shifted from proving DNA's catalytic ability to proving its practical utility. DNAzymes have already found employment as biosensors, diagnostic tools, and probable therapeutic agents. However, their rugged durability, facile synthesis, and amenability to surface immobilization and chemical modification, are enduring characteristics that will continue to make DNAzymes attractive targets for innovative applications above and beyond our current imagination.

References

Altman, S., Baer, M. F., Bartkiewicz, M., Gold, H., Guerrier-Takada, C., Kirsebom, L. A., Lumelsky, N., Peck, K. (1989). Catalysis by the RNA subunit of RNase P - a minireview. Gene 82, 63-64.

Basu, S., Sriram, B., Goila, R., Banerjea, A. C. (2000). Targeted cleavage of HIV-1 corecep-tor-CXCR-4 by RNA-cleaving DNA-enzyme: inhibition of coreceptor function. Antiviral Res 46, 125-134.

Bittker, J. A., Le, B. V, Liu, D. R. (2002). Nucleic acid evolution and minimization by nonhomologous random recombination. Nat Biotechnol 20, 1024-1029.

Bittker, J. A., Le, B. V, Liu, J. M., Liu, D. R. (2004). Directed evolution of protein enzymes using nonhomologous random recombination. Proc Natl Acad Sci USA 101, 7011-7016.

Blount, K. F., Uhlenbeck, O. C. (2002). The hammerhead ribozyme. Biochem Soc Trans 30, 1119-1122.

Breaker, R. R. (1997). In vitro selection of catalytic polynucleotides. Chem Rev 97, 371-390.

Breaker, R. R., Joyce, G. F. (1994). A DNA enzyme that cleaves RNA. Chem Biol 1, 223-229.

Breaker, R. R., Joyce, G. F. (1995). A DNA enzyme with Mg(II)-dependent RNA phos-phoesterase activity. Chem Biol 2, 655-660.

Cairns, M. J., Hopkins, T. M., Witherington, C., Wang, L., Sun, L. Q. (1999). Target site selection for an RNA-cleaving catalytic DNA. Nat Biotechnol 17, 480-486.

Carmi, N., Shultz, L. A., Breaker, R. R. (1996). In vitro selection of self-cleaving DNAs. Chem Biol 3, 1039-1046.

Carmi, N., Balkhi, S. R., Breaker, R. R. (1998). Cleaving DNA with DNA. Proc Natl Acad Sci USA 95, 2233-2237.

Cech, T. R. (2002). Ribozymes, the first 20 years. Biochem Soc Trans 30, 1162-1166.

Cech, T. R., Bass, B. L. (1986). Biological catalysis by RNA. Annu Rev Biochem 55, 599-629.

Chakraborti, S., Banerjea, A. C. (2003). Inhibition of HIV-1 gene expression by novel DNA enzymes targeted to cleave HIV-1 TAR RNA: potential effectiveness against all HIV-1 isolates. Mol Ther 7, 817-826.

Chapman, K. B., Szostak, J. W. (1994). In vitro selection of catalytic RNAs. Curr Opin Struct Biol 4, 618-622.

Chen, Y., Mao, C. (2004). Putting a brake on an autonomous DNA nanomotor. J Am Chem Soc 126, 8626-8627.

Chen, Y., McMicken, H. W. (2003). Intracel-lular production of DNA enzyme by a novel single-stranded DNA expression vector. Gene Ther 10, 1776-1780.

Chen, Y., Ji, Y. J., Roxby, R., Conrad, C. (2000). In vivo expression of single-stranded DNA in mammalian cells with DNA enzyme sequences targeted to C-raf. Antisense Nucleic Acid Drug Dev 10, 415-422.

Chen, Y., Ji, Y. J., Conrad, C. (2003). Expression of ssDNA in mammalian cells. Biotechniques 34, 167-171.

Chen, Y., Wang, M., Mao, C. (2004). An autonomous DNA nanomotor powered by a DNA enzyme. Angew Chem Int Ed 43, 3554-3557.

Chinnapen, D. J., Sen, D. (2004). A deoxyri-bozyme that harnesses light to repair thymine dimers in DNA. Proc Natl Acad Sci USA 101, 65-69.

Cieslak, M., Niewiarowska, J., Nawrot, M., Koziolkiewicz, M., Stec, W. J., Cierniewski, C. S. (2002). DNAzymes to beta 1 and beta 3 mRNA down-regulate expression of the targeted integrins and inhibit endothelial cell capillary tube formation in fibrin and matrigel. J Biol Chem 277, 6779-6787.

Cochran, A. G., Schultz, P. G. (1990). Antibody-catalyzed porphyrin metallation. Science 249, 781-783.

Coppins, R. L., Silverman, S. K. (2004). A DNA enzyme that mimics the first step of RNA splicing. Nat Struct Mol Biol 11, 270-274.

Cruz, R. P. G., Withers, J. W., Li, Y. (2004). Dinucleotide junction cleavage versatility of 8-17 deoxyribozyme. Chem Biol 11, 57-67.

Cuenoud, B., Szostak, J. W (1995). A DNA metalloenzyme with DNA ligase activity. Nature 375, 611-614.

Dash, B. C., Harikrishnan, T. A., Goila, R., Shahi, S., Unwalla, H., Husain, S., Banerjea, A. C. (1998). Targeted cleavage of HIV-1 envelope gene by a DNA enzyme and inhibition of HIV-1 envelope-CD4 mediated cell fusion. FEBS Lett 431, 395-399.

Ellington, A. D., Szostak, J. W. (1990). In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818-822.

Fahmy, R. G., Khachigian, L. M. (2004). Locked nucleic acid modified DNA enzymes targeting early growth response-1 inhibit human vascular smooth muscle cell growth. Nucleic Acids Res 32, 2281-2285.

Faulhammer, D., Famulok, M. (1996). The Ca(II) ion as a cofactor for a novel RNA-cleaving deoxyribozyme. Angew Chem Int Ed Engl 35, 2809-2813.

Faulhammer, D., Famulok, M. (1997). Characterization and divalent metal-ion dependence of in vitro selected deoxyribozymes which cleave DNA/RNA chimeric oligonucleotides. J Mol Biol 269, 188-202.

Feldman, A. R., Sen, D. (2001). A new and efficient DNA enzyme for the sequence-specific cleavage of RNA. J Mol Biol 313, 283-294.

Ferre-D'Amare, A. R. (2004). The hairpin ribozyme. Biopolymers 73, 71-78.

Flynn-Charlebois, A., Prior, T. K., Hoadley, K. A., Silverman, S. K. (2003a). In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'. J Am Chem Soc 125, 53465350.

Flynn-Charlebois, A., Wang, Y., Prior, T. K., Rashid, I., Hoadley, K. A., Coppins, R. L., Wolf, A. C., Silverman, S. K. (2003b). Deoxyribozymes with 2'-5' RNA ligase activity. J Am Chem Soc 125, 2444-2454.

Geyer, C. R., Sen, D. (1997). Evidence for the metal-cofactor independence of an RNA phosphodiester-cleaving DNA enzyme. Chem Biol 4, 579-593.

Gilbert, W (1986). The RNA world. Nature 319, 618.

Grimpe, B., Silver, J. (2004). A novel DNA enzyme reduces glycosaminoglycan chains in the glial scar and allows microtransplanted dorsal root ganglia axons to regenerate beyond lesions in the spinal cord. J Neurosci 24, 1393-1397.

Grimpe, B., Dong, S., Doller, C., Temple, K., Malouf, A. T., Silver, J. (2002). The critical role of basement membrane-independent laminin gamma 1 chain during axon regeneration in the CNS. J Neurosci 22, 3144-3160.

Guerrier-Takada, C., Gardiner, K., Marsh, T., Pace, N., Altman, S. (1983). The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell 35, 849-857.

Hjiantoniou, E., Iseki, S., Uney, J., Phylactou, L. (2003). DNazyme-mediated cleavage of Twist transcripts and increase in cellular apoptosis. Biochem Biophys Res Commun 300, 178-181.

(2001). DNA enzyme targeting TNF-alpha mRNA improves hemodynamic performance in rats with postinfarction heart failure. Am J Physiol Heart Circ Physiol 281, H2211-2217.

(2002). Targeting Raf-1 gene expression by a DNA enzyme inhibits juvenile myelomo-nocytic leukemia cell growth. Blood 99, 4147-4153.

Jaschke, A. (2001). Artificial ribozymes and deoxyribozymes. Curr Opin Struct Biol 11, 321-326.

Joyce, G. F. (1991). The rise and fall of the RNA world. New Biol 3, 399-407.

Joyce, G. F. (1994). In vitro evolution of nucleic acids. Curr Opin Struct Biol 4, 331-336.

Khachigian, L. M., Fahmy, R. G., Zhang, G., Bobryshev, Y. V., Kaniaros, A. (2002). c-Jun regulates vascular smooth muscle cell growth and neointima formation after arterial injury. Inhibition by a novel DNA enzyme targeting c-Jun. J Biol Chem 277, 22985-22991.

Kruger, K., Grabowski, P. J., Zaug, A. J., Sands, J., Gottschling, D. E., Cech, T. R. (1982). Self-splicing RNA: autoexcision and autocyclization of the ribosomal RNA intervening sequence of Tetrahymena. Cell 31, 147-157.

Kurreck, J., Bieber, B., Jahnel, R., Erdmann, V. A. (2002). Comparative study of DNA enzymes and ribozymes against the same full-length messenger RNA of the vanilloid receptor subtype I. J Biol Chem 277, 7099-7107.

Lehman, N. (2004). Assessing the likelihood of recurrence during RNA evolution in vitro. Artif Life 10, 1-22.

Lermer, L., Roupioz, Y., Ting, R., Perrin, D. M. (2002). Toward an RNaseA mimic: A DNAzyme with imidazoles and cationic amines. J Am Chem Soc 124, 9960-9961.

Levy, M., Ellington, A. D. (2001). Selection of deoxyribozyme ligases that catalyze the formation of an unnatural internucleotide linkage. Bioorg Med Chem 9, 2581-2587.

Levy, M., Ellington, A. D. (2002). In vitro selection of a deoxyribozyme that can utilize multiple substrates. J Mol Evol 54, 180-190.

Li, J., Lu, Y. (2000). A highly sensitive and selective catalytic DNA biosensor for lead ions. J Am Chem Soc 122, 10466-10467.

Li, J., Zheng, W., Kwon, A. H., Lu, Y. (2000). In vitro selection and characterization of a highly efficient Zn(II)-dependent RNA-cleaving deoxyribozyme. Nucleic Acids Res 28, 481-488.

Li, Y., Breaker, R. R. (1999). Phosphorylating DNA with DNA. Proc Natl Acad Sci USA 96, 2746-2751.

Li, Y., Sen, D. (1996). A catalytic DNA for porphyrin metallation. Nat Struct Biol 3, 743-747.

Li, Y., Sen, D. (1997). Toward an efficient DNAzyme. Biochemistry 36, 5589-5599.

Li, Y., Geyer, C. R., Sen, D. (1996). Recognition of anionic porphyrins by DNA aptamers. Biochemistry 35, 6911-6922.

Li, Y., Liu, Y., Breaker, R. R. (2000). Capping DNA with DNA. Biochemistry 39, 31063114.

Lilley, D. M. (2004). The Varkud satellite ribozyme. RNA 10, 151-158.

Liu, C., Cheng, R., Sun, L. Q., Tien, P. (2001). Suppression of platelet-type 12-lipoxygen-ase activity in human erythroleukemia cells by an RNA-cleaving DNAzyme. Biochem Biophys Res Commun 284, 1077-1082.

Liu, J., Lu, Y. (2003). A colorimetric lead biosensor using DNAzyme-directed assembly of gold nanoparticles. J Am Chem Soc 125, 6642-6643.

Liu, Z., Mei, S. H., Brennan, J. D., Li, Y. (2003). Assemblage of signaling DNA enzymes with intriguing metal-ion specificities and pH dependences. J Am Chem Soc 125, 7539-7545.

Lorsch, J. R., Szostak, J. W. (1996). Chance and necessity in the selection of nucleic acid catalysts. Acc Chem Res 29, 103-110.

Lowe, H. C., Fahmy, R. G., Kavurma, M. M., Baker, A., Chesterman, C. N., Khachigian, L. M. (2001). Catalytic oligodeoxynucleo-tides define a key regulatory role for early growth response factor-1 in the porcine model of coronary in-stent restenosis. Circ Res 89, 670-677.

Lowe, H. C., Chesterman, C. N., Khachigian, L. M. (2002). Catalytic antisense DNA molecules targeting Egr-1 inhibit neointima formation following permanent ligation of rat common carotid arteries. Thromb Haemost 87, 134-140.

Mei, S. H., Liu, Z., Brennan, J. D., Li, Y. (2003). An efficient RNA-cleaving DNA enzyme that synchronizes catalysis with fluorescence signaling. J Am Chem Soc 125, 412-420.

Mitchell, A., Dass, C. R., Sun, L. Q., Khachi-gian, L. M. (2004). Inhibition of human breast carcinoma proliferation, migration, chemoinvasion and solid tumour growth by DNAzymes targeting the zinc finger transcription factor EGR-1. Nucleic Acids Res 32, 3065-3069.

Orgel, L. E. (1986). RNA catalysis and the origins of life. J Theor Biol 123, 127-149.

Pan, T., Uhlenbeck, O. C. (1992). In vitro selection of RNAs that undergo autolytic cleavage with Pb2+. Biochemistry 31, 3887-3895.

Paquette, J., Nicoghosian, K., Qi, G. R., Beauchemin, N., Cedergren, R. (1990). The conformation of single-stranded nucleic acids tDNA versus tRNA. Eur J Biochem 189, 259-265.

Peracchi, A. (2000). Preferential activation of the 8-17 deoxyribozyme by Ca(2+) ions. Evidence for the identity of 8-17 with the catalytic domain of the Mg5 deoxyribozyme. J Biol Chem 275, 11693-11697.

Perreault, J. P., Wu, T. F., Cousineau, B., Ogilvie, K. K., Cedergren, R. (1990). Mixed deoxyribo- and ribo-oligonucleotides with catalytic activity. Nature 344, 565-567.

Perrin, D. M., Garestier, T., Helene, C. (2001). Bridging the gap between proteins and nucleic acids: a metal-independent RNAseA mimic with two protein-like functionalities. J Am Chem Soc 123, 1556-1563.

Roth, A., Breaker, R. R. (1998). An amino acid as a cofactor for a catalytic polynucleotide. Proc Natl Acad Sci USA 95, 6027-6031.

Sando, S., Sasaki, T., Kanatani, K., Aoyama, Y. (2003). Amplified nucleic acid sensing using programmed self-cleaving DNAzyme. J Am Chem Soc 125, 15720-15721.

Santiago, F. S., Lowe, H. C., Kavurma, M. M., Chesterman, C. N., Baker, A., Atkins, D. G., Khachigian, L. M. (1999). New DNA enzyme targeting Egr-1 mRNA inhibits vascular smooth muscle proliferation and re-growth after injury. Nat Med 5, 1264-1269.

Santoro, S. W., Joyce, G. F. (1997). A general purpose RNA-cleaving DNA enzyme. Proc Natl Acad Sci USA 94, 4262-4266.

Santoro, S. W., Joyce, G. F. (1998). Mechanism and utility of an RNA-cleaving DNA enzyme. Biochemistry 37, 13330-13342.

Santoro, S. W., Joyce, G. F., Sakthivel, K., Gramatikova, S., Barbas, C. F., 3rd (2000). RNA cleavage by a DNA enzyme with extended chemical functionality. J Am Chem Soc 122, 2433-2439.

Schlosser, K., Li, Y. (2004). Tracing sequence diversity change of RNA-cleaving deoxyri-bozymes under increasing selection pressure during in vitro selection. Biochemistry 43, 9695-9707.

Sheppard, T. L., Ordoukhanian, P., Joyce, G. F. (2000). A DNA enzyme with N-glycosylase activity. Proc Natl Acad Sci USA 97, 78027807.

Sidorov, A. V., Grasby, J. A., Williams, D. M. (2004). Sequence-specific cleavage of RNA in the absence of divalent metal ions by a DNAzyme incorporating imidazolyl and amino functionalities. Nucleic Acids Res 32, 1591-1601.

Sioud, M., Leirdal, M. (2000). Design of nuclease resistant protein kinase C alpha DNA enzymes with potential therapeutic application. J Mol Biol 296, 937-947.

Sreedhara, A., Li, Y., Breaker, R. R. (2004). Ligating DNA with DNA. J Am Chem Soc 126, 3454-3460.

Sriram, B., Banerjea, A. C. (2000). In vitro-se-lected RNA cleaving DNA enzymes from a combinatorial library are potent inhibitors of HIV-1 gene expression. Biochem J 352, 667-673.

Sun, L. Q., Cairns, M. J., Gerlach, W. L., Witherington, C., Wang, L., King, A. (1999). Suppression of smooth muscle cell proliferation by a c-myc RNA-cleaving deoxyri-bozyme. J Biol Chem 274, 17236-17241.

Symons, R. H. (1992). Small catalytic RNAs. Annu Rev Biochem 61, 641-671.

Takahashi, H., Hamazaki, H., Habu, Y., Hayashi, M., Abe, T., Miyano-Kurosaki, N., Takaku, H. (2004). A new modified DNA enzyme that targets influenza virus A mRNA inhibits viral infection in cultured cells. FEBS Lett 560, 69-74.

Tan, X. X., Rose, K., Margolin, W., Chen, Y. (2004). DNA enzyme generated by a novel single-stranded DNA expression vector inhibits expression of the essential bacterial cell division gene ftsZ. Biochemistry 43, 1111-1117.

Tuerk, C., Gold, L. (1990). Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505-510.

Unwalla, H., Banerjea, A. C. (2001a). Inhibition of HIV-1 gene expression by novel macrophage-tropic DNA enzymes targeted to cleave HIV-1 TAT/Rev RNA. Biochem J 357, 147-155.

Unwalla, H., Banerjea, A. C. (2001b). Novel mono- and di-DNA-enzymes targeted to cleave TAT or TAT-REV RNA inhibit HIV-1 gene expression. Antiviral Res 51, 127-139.

Vester, B., Lundberg, L. B., Sorensen, M. D., Babu, B. R., Douthwaite, S., Wengel, J. (2002). LNAzymes: Incorporation of LNA-type monomers into DNAzymes markedly increases RNA cleavage. J Am Chem Soc 124, 13682-13683.

Wang, W., Billen, L. P., Li, Y. (2002). Sequence diversity, metal specificity, and catalytic proficiency of metal-dependent phosphory-lating DNA enzymes. Chem Biol 9, 507-517.

Wang, Y., Silverman, S. K. (2003). Deoxyribo-zymes that synthesize branched and lariat RNA. J Am Chem Soc 125, 6880-6881.

Warashina, M., Kuwabara, T., Nakamatsu, Y., Taira, K. (1999). Extremely high and specific activity of DNA enzymes in cells with a Philadelphia chromosome. Chem Biol 6, 237-250.

Wilson, D. S., Szostak, J. W. (1999). In vitro selection of functional nucleic acids. Annu Rev Biochem 68, 611-647.

Wu, Y., Yu, L., McMahon, R., Rossi, J. J., Forman, S. J., Snyder, D. S. (1999). Inhibition of bcr-abl oncogene expression by novel deoxyribozymes (DNAzymes). Hum Gene Ther 10, 2847-2857.

Xu, Y., Kool, E. T. (1999). High sequence fidelity in a non-enzymatic DNA autoligation reaction. Nucleic Acids Res 27, 875-881.

Yen, L., Strittmatter, S. M., Kalb, R. G. (1999). Sequence-specific cleavage of Huntingtin mRNA by catalytic DNA. Ann Neurol 46, 366-373.

Zhang, G., Dass, C. R., Sumithran, E., Di Girolamo, N., Sun, L. Q., Khachigian, L. M. (2004). Effect of deoxyribozymes targeting c-Jun on solid tumor growth and angio-genesis in rodents. J Natl Cancer Inst 96, 683-696.

Zhang, L., Gasper, W. J., Stass, S. A., Ioffe, O. B., Davis, M. A., Mixson, A. J. (2002). Angiogenic inhibition mediated by a DNAzyme that targets vascular endothelial growth factor receptor 2. Cancer Res 62, 5463-5469.

Zhang, X., Xu, Y., Ling, H., Hattori, T. (1999). Inhibition of infection of incoming HIV-1 virus by RNA-cleaving DNA enzyme. FEBS Lett 458, 151-156.

0 0

Post a comment